BEAST v1.7.0 Parser Library (2002-2012)

<!-- An alignment of three short DNA sequences -->
<alignment missing="-?" dataType="nucleotide">
  <sequence>
    <taxon idref="taxon1"/>
    ACGACTAGCATCGAGCTTCG--GATAGCAGGC
  </sequence>
  <sequence>
    <taxon idref="taxon2"/>
    ACGACTAGCATCGAGCTTCGG-GATAGCATGC
  </sequence>
  <sequence>
    <taxon idref="taxon3"/>
    ACG?CTAGAATCGAGCTTCGAGGATAGCATGC
  </sequence>
</alignment>

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>

<!-- the tree model as special sockets for attaching parameters to various aspects of the tree     -->
<!-- The treeModel below shows the standard setup with a parameter associated with the root height -->
<!-- a parameter associated with the internal node heights (minus the root height) and             -->
<!-- a parameter associates with all the internal node heights                                     -->
<!-- Notice that these parameters are overlapping                                                  -->
<!-- The parameters are subsequently used in operators to propose changes to the tree node heights -->
<treeModel id="treeModel1">
	<tree idref="startingTree"/>
	<rootHeight>
		<parameter id="treeModel1.rootHeight"/>
	</rootHeight>
	<nodeHeights internalNodes="true" rootNode="false">
		<parameter id="treeModel1.internalNodeHeights"/>
	</nodeHeights>
	<nodeHeights internalNodes="true" rootNode="true">
		<parameter id="treeModel1.allInternalNodeHeights"/>
	</nodeHeights>
</treeModel>

<!-- a date representing 10 years in the past                                 -->
<date value="10.0" units="years" direction="backwards"/>

<!-- a date representing 300 days after Jan 1st 1989                          -->
<date value="300.0" origin="01/01/89" units="days" direction="forwards"/>

<!-- The XML for a nucleotide data type under this scheme would be -->
<generalDataType id="nucleotides">
	<state code="A"/>
	<state code="C"/>
	<state code="G"/>
	<state code="T"/>
	<alias code="U" state="T"/>
	<ambiguity code="R" states="AG"/>
	<ambiguity code="Y" states="CT"/>
	<ambiguity code="?" states="ACGT"/>
	<ambiguity code="-" states="ACGT"/>
</generalDataType>

<!-- A general time reversible model for DNA.                                          -->
<!-- This element must have parameters for exactly five of the six rates               -->
<!-- The sixth rate has an implied value of 1.0 and all other rates are relative to it -->
<!-- This example parameterizes the rate matrix relative to the A<->G transition       -->
<gtrModel id="gtr1">
	<frequencies> <frequencyModel idref="freqs"/> </frequencies>
	<rateAC> <parameter id="rateAC" value="1.0"/> </rateAC>
	<rateAT> <parameter id="rateAT" value="1.0"/> </rateAT>
	<rateCG> <parameter id="rateCG" value="1.0"/> </rateCG>
	<rateCT> <parameter id="rateCT" value="1.0"/> </rateCT>
	<rateGT> <parameter id="rateGT" value="1.0"/> </rateGT>
</gtrModel>

<!-- The logArg element takes an argModel to be logged -->
<logArg logEvery="100" fileName="log.args">
	<argModel idref="treeModel1"/>
</logArg>

<!-- The logArgTree element takes an argTreeModel to be logged -->
<logArgTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logArgTree>

<!-- The logHiddenLinkageTree element takes a treeModel to be logged -->
<logHiddenLinkageTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logHiddenLinkageTree>

<!-- The logTree element takes a treeModel to be logged -->
<logTree logEvery="100" fileName="log.trees" nexusFormat="true">
	<treeModel idref="treeModel1"/>
</logTree>

<microsatellite min="0" max="20" unitLength="2"/>

<newick units="years"> ((A:1.0, B:1.0):1.0,(C:2.0, D:2.0):1.0); </newick>